Transcript: Mouse XM_017313347.1

PREDICTED: Mus musculus protein phosphatase 2, regulatory subunit B'', alpha (Ppp2r3a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r3a (235542)
Length:
6641
CDS:
446..3898

Additional Resources:

NCBI RefSeq record:
XM_017313347.1
NBCI Gene record:
Ppp2r3a (235542)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313347.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081395 CCACGGTTGTTCAGAGAATAT pLKO.1 2982 CDS 100% 13.200 18.480 N Ppp2r3a n/a
2 TRCN0000081397 CCGTTATTAACCATAAACCAT pLKO.1 1625 CDS 100% 3.000 4.200 N Ppp2r3a n/a
3 TRCN0000081393 CCTTGAACTTACCTGGTTTAA pLKO.1 4378 3UTR 100% 13.200 9.240 N Ppp2r3a n/a
4 TRCN0000081394 GCTCATTTGAAGACTATGAAT pLKO.1 3771 CDS 100% 5.625 3.938 N Ppp2r3a n/a
5 TRCN0000081396 CCATACATTATTGCACTGGAA pLKO.1 525 CDS 100% 2.640 1.584 N Ppp2r3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313347.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06760 pDONR223 100% 87.1% 85.2% None (many diffs) n/a
2 ccsbBroad304_06760 pLX_304 0% 87.1% 85.2% V5 (many diffs) n/a
Download CSV