Transcript: Mouse XM_017313452.1

PREDICTED: Mus musculus zinc finger with KRAB and SCAN domains 7 (Zkscan7), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zkscan7 (382118)
Length:
5859
CDS:
692..1705

Additional Resources:

NCBI RefSeq record:
XM_017313452.1
NBCI Gene record:
Zkscan7 (382118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1493 CDS 100% 6.000 3.000 Y Zfp612 n/a
2 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 3207 3UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313452.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09977 pDONR223 100% 83.5% 86% None (many diffs) n/a
2 ccsbBroad304_09977 pLX_304 0% 83.5% 86% V5 (many diffs) n/a
3 TRCN0000477896 TCCACCTTATGCACCGACGTTCCA pLX_317 45.7% 83.5% 86% V5 (many diffs) n/a
Download CSV