Transcript: Mouse XM_017313467.1

PREDICTED: Mus musculus ubiquitin specific peptidase 2 (Usp2), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp2 (53376)
Length:
3328
CDS:
285..1562

Additional Resources:

NCBI RefSeq record:
XM_017313467.1
NBCI Gene record:
Usp2 (53376)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328117 CACGCTTCATGGGCTATAATC pLKO_005 700 CDS 100% 13.200 18.480 N Usp2 n/a
2 TRCN0000030749 CCACGCTTCATGGGCTATAAT pLKO.1 699 CDS 100% 15.000 12.000 N Usp2 n/a
3 TRCN0000374713 CACCCGAGAGCTGAGAGATTA pLKO_005 518 CDS 100% 13.200 10.560 N Usp2 n/a
4 TRCN0000328119 TTACCCTGAGGTGACGTTAAT pLKO_005 1091 CDS 100% 13.200 10.560 N Usp2 n/a
5 TRCN0000030753 CGATTCTCAGAATCCAGGATA pLKO.1 1254 CDS 100% 4.950 3.960 N Usp2 n/a
6 TRCN0000353405 CTGCCGAGCAGAAGTTGATAC pLKO_005 1731 3UTR 100% 10.800 7.560 N Usp2 n/a
7 TRCN0000374779 TGGCTTCTCTCGTTTGCATTT pLKO_005 1871 3UTR 100% 10.800 7.560 N Usp2 n/a
8 TRCN0000007280 CCATGCTGTTTACAACCTGTA pLKO.1 1355 CDS 100% 4.050 2.835 N USP2 n/a
9 TRCN0000030751 GAAAGGGAAGACAGTCGGATT pLKO.1 870 CDS 100% 4.050 2.835 N Usp2 n/a
10 TRCN0000030752 CCTGAGGTGACGTTAATGGAT pLKO.1 1095 CDS 100% 3.000 2.100 N Usp2 n/a
11 TRCN0000030750 GCTCACAACATTTGTGAATTT pLKO.1 1286 CDS 100% 1.320 0.924 N Usp2 n/a
12 TRCN0000374780 TTCACCAAAGAGGACATATTG pLKO_005 1128 CDS 100% 13.200 7.920 N Usp2 n/a
13 TRCN0000433402 ATGAGCCAAGAGCCCTCTTCA pLKO_005 2106 3UTR 100% 4.950 3.465 N USP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489958 ATCTGTATCTTTTCAGCGCTCCAT pLX_317 25.8% 54.6% 53.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488149 TATCCGTTTGACCTACCCCGACCG pLX_317 14% 54.5% 53.4% V5 (many diffs) n/a
Download CSV