Transcript: Mouse XM_017313543.1

PREDICTED: Mus musculus U2 snRNP-associated SURP domain containing (U2surp), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
U2surp (67958)
Length:
7578
CDS:
1205..3067

Additional Resources:

NCBI RefSeq record:
XM_017313543.1
NBCI Gene record:
U2surp (67958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221605 CGTACAATTCAAGGCCATTTA pLKO.1 1880 CDS 100% 13.200 18.480 N U2SURP n/a
2 TRCN0000336768 CGTACAATTCAAGGCCATTTA pLKO_005 1880 CDS 100% 13.200 18.480 N U2SURP n/a
3 TRCN0000103868 GCGGGATAAGTTAGAAGAAAT pLKO.1 1591 CDS 100% 13.200 18.480 N U2surp n/a
4 TRCN0000103869 GCAATTTATCCAGAACCATTT pLKO.1 1958 CDS 100% 10.800 15.120 N U2surp n/a
5 TRCN0000103866 CGACTGAGTCTAAGTTCTCTA pLKO.1 2451 CDS 100% 4.950 6.930 N U2surp n/a
6 TRCN0000103865 GCCCATCTTCTGAGCAATTAA pLKO.1 3816 3UTR 100% 15.000 10.500 N U2surp n/a
7 TRCN0000103867 CCACCTTTAAATCCATACCTT pLKO.1 1493 CDS 100% 3.000 2.100 N U2surp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11725 pDONR223 100% 91.5% 98.7% None (many diffs) n/a
2 ccsbBroad304_11725 pLX_304 0% 91.5% 98.7% V5 (many diffs) n/a
3 TRCN0000479492 AGACACCAACCGTTCTGATGTGGT pLX_317 16.1% 91.5% 98.7% V5 (many diffs) n/a
Download CSV