Transcript: Mouse XM_017313667.1

PREDICTED: Mus musculus centrosomal protein 57 (Cep57), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cep57 (74360)
Length:
2708
CDS:
549..1892

Additional Resources:

NCBI RefSeq record:
XM_017313667.1
NBCI Gene record:
Cep57 (74360)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120988 GCCAATCAGATAACTAAAGTT pLKO.1 1620 CDS 100% 5.625 7.875 N Cep57 n/a
2 TRCN0000424830 ATTGGAATACATGCGAAATAT pLKO_005 905 CDS 100% 15.000 12.000 N Cep57 n/a
3 TRCN0000143673 GAGTGTGAATTGGAGGCATTA pLKO.1 1578 CDS 100% 10.800 8.640 N CEP57 n/a
4 TRCN0000427968 ATGTACCTCACTGGTCATAAA pLKO_005 1909 3UTR 100% 13.200 9.240 N Cep57 n/a
5 TRCN0000438581 AGAACGGCAGCATGATCAAAC pLKO_005 986 CDS 100% 10.800 7.560 N Cep57 n/a
6 TRCN0000120990 GCAGTGTTAATGAAGAACTTT pLKO.1 1447 CDS 100% 5.625 3.938 N Cep57 n/a
7 TRCN0000120991 CAGCAGCTTACTAAACTCATA pLKO.1 1521 CDS 100% 4.950 3.465 N Cep57 n/a
8 TRCN0000142782 CAGGCAGAAGAAAGTGTGAAA pLKO.1 732 CDS 100% 4.950 3.465 N CEP57 n/a
9 TRCN0000120987 GCACTGTTTAATCTTGACTTA pLKO.1 2528 3UTR 100% 4.950 3.465 N Cep57 n/a
10 TRCN0000120989 CCACCTGATAAGCCTTTCCTT pLKO.1 585 CDS 100% 3.000 2.100 N Cep57 n/a
11 TRCN0000121760 CAGACTTTACAGGATGAATTT pLKO.1 1479 CDS 100% 13.200 6.600 Y CEP57 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11406 pDONR223 100% 45.8% 47.2% None (many diffs) n/a
2 ccsbBroad304_11406 pLX_304 0% 45.8% 47.2% V5 (many diffs) n/a
3 TRCN0000472167 GTGGCTCGCATGTCCTGGGGGTCG pLX_317 60% 45.8% 47.2% V5 (many diffs) n/a
Download CSV