Transcript: Mouse XM_017314101.1

PREDICTED: Mus musculus family with sequence similarity 13, member C (Fam13c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam13c (71721)
Length:
3162
CDS:
230..1789

Additional Resources:

NCBI RefSeq record:
XM_017314101.1
NBCI Gene record:
Fam13c (71721)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000327991 GCTACCTGCTAGCGAAGATTT pLKO_005 2090 3UTR 100% 13.200 18.480 N Fam13c n/a
2 TRCN0000217691 GTGCGACTTCAACCAAGAATA pLKO.1 407 CDS 100% 13.200 18.480 N Fam13c n/a
3 TRCN0000217537 CCATCCCTTATCCCAACAATT pLKO.1 1346 CDS 100% 13.200 9.240 N Fam13c n/a
4 TRCN0000327989 GCGAGAATTTGAAGAACAATT pLKO_005 1627 CDS 100% 13.200 9.240 N Fam13c n/a
5 TRCN0000327990 GACGATGGGAAGGGAACTAAG pLKO_005 1259 CDS 100% 10.800 7.560 N Fam13c n/a
6 TRCN0000328061 TAGACCAGAGGGCTACCATTT pLKO_005 426 CDS 100% 10.800 7.560 N Fam13c n/a
7 TRCN0000200063 CCAAAGCCTCAAGAGGAAGAT pLKO.1 922 CDS 100% 4.950 3.465 N Fam13c n/a
8 TRCN0000177533 CGAAGTTCTGAAATGGATGAA pLKO.1 1015 CDS 100% 4.950 3.465 N Fam13c n/a
9 TRCN0000200295 GAGTCCACAAAGCAGCATCTT pLKO.1 370 CDS 100% 4.950 3.465 N Fam13c n/a
10 TRCN0000328060 GAGTCCACAAAGCAGCATCTT pLKO_005 370 CDS 100% 4.950 3.465 N Fam13c n/a
11 TRCN0000197716 GCTGTTTATGAATCAGAGTAA pLKO.1 2940 3UTR 100% 4.950 3.465 N Fam13c n/a
12 TRCN0000176887 GCATCTTTCTTAATGTTCCAA pLKO.1 2581 3UTR 100% 3.000 2.100 N Fam13c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09861 pDONR223 100% 70.2% 71.4% None (many diffs) n/a
2 ccsbBroad304_09861 pLX_304 0% 70.2% 71.4% V5 (many diffs) n/a
3 TRCN0000480797 ATTGTAGACACCCAGCCTCTTCTG pLX_317 23.4% 70.2% 71.4% V5 (many diffs) n/a
4 ccsbBroadEn_05246 pDONR223 100% 57.6% 58.5% None (many diffs) n/a
5 ccsbBroad304_05246 pLX_304 0% 57.6% 58.5% V5 (many diffs) n/a
6 TRCN0000478166 GTGCACATTTGCTGCCGACCAACA pLX_317 14.4% 57.6% 58.5% V5 (many diffs) n/a
Download CSV