Transcript: Mouse XM_017314585.1

PREDICTED: Mus musculus vacuolar protein sorting 25 (Vps25), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vps25 (28084)
Length:
459
CDS:
74..406

Additional Resources:

NCBI RefSeq record:
XM_017314585.1
NBCI Gene record:
Vps25 (28084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173175 CTTCTTTACGTTACAGCCGAA pLKO.1 175 CDS 100% 2.160 3.024 N Vps25 n/a
2 TRCN0000175819 GCCAGAATAACTCTGTGTTTA pLKO.1 397 CDS 100% 13.200 9.240 N Vps25 n/a
3 TRCN0000336110 GCCAGAATAACTCTGTGTTTA pLKO_005 397 CDS 100% 13.200 9.240 N Vps25 n/a
4 TRCN0000381813 ACGTCAAGCTACAGCGGAAAC pLKO_005 315 CDS 100% 6.000 4.200 N Vps25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314585.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04373 pDONR223 100% 44.1% 44.6% None (many diffs) n/a
2 ccsbBroad304_04373 pLX_304 0% 44.1% 44.6% V5 (many diffs) n/a
3 TRCN0000471308 CCTAGACTTCTCAAATCAGGACAC pLX_317 80.8% 44.1% 44.6% V5 (many diffs) n/a
Download CSV