Transcript: Mouse XM_017314702.1

PREDICTED: Mus musculus pescadillo ribosomal biogenesis factor 1 (Pes1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pes1 (64934)
Length:
2382
CDS:
230..2071

Additional Resources:

NCBI RefSeq record:
XM_017314702.1
NBCI Gene record:
Pes1 (64934)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102591 CCGTAGGCTCACTGTGGAGTT pLKO.1 712 CDS 100% 1.350 1.890 N Pes1 n/a
2 TRCN0000324646 CCGTAGGCTCACTGTGGAGTT pLKO_005 712 CDS 100% 1.350 1.890 N Pes1 n/a
3 TRCN0000102594 CGAGAGTACAAGGTGTTTGTT pLKO.1 476 CDS 100% 5.625 4.500 N Pes1 n/a
4 TRCN0000353861 CGAGAGTACAAGGTGTTTGTT pLKO_005 476 CDS 100% 5.625 4.500 N Pes1 n/a
5 TRCN0000102592 GATGACAACGAAGGTGATGTT pLKO.1 1616 CDS 100% 4.950 3.465 N Pes1 n/a
6 TRCN0000102593 GATGATGACAACGAAGGTGAT pLKO.1 1613 CDS 100% 4.050 2.835 N Pes1 n/a
7 TRCN0000353932 GATGATGACAACGAAGGTGAT pLKO_005 1613 CDS 100% 4.050 2.835 N Pes1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314702.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02777 pDONR223 100% 82% 84.9% None (many diffs) n/a
2 ccsbBroad304_02777 pLX_304 0% 82% 84.9% V5 (many diffs) n/a
3 TRCN0000474494 GCTGCTAACCAGGACTGGCGTCTT pLX_317 23.2% 82% 84.9% V5 (many diffs) n/a
Download CSV