Transcript: Mouse XM_017314927.1

PREDICTED: Mus musculus JNK1/MAPK8-associated membrane protein (Jkamp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jkamp (104771)
Length:
798
CDS:
72..758

Additional Resources:

NCBI RefSeq record:
XM_017314927.1
NBCI Gene record:
Jkamp (104771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175511 CTTATATTACGCCTTCCCGTA pLKO.1 458 CDS 100% 2.160 3.024 N Jkamp n/a
2 TRCN0000264602 ACGCGTTCTGCTTGGTGTTAA pLKO_005 304 CDS 100% 13.200 10.560 N Jkamp n/a
3 TRCN0000264604 TCTGGTTACCCTGGCTGTATA pLKO_005 497 CDS 100% 13.200 10.560 N Jkamp n/a
4 TRCN0000264601 ATTACGCCTTCCCGTACATTA pLKO_005 463 CDS 100% 13.200 9.240 N Jkamp n/a
5 TRCN0000264603 TGGCTCTATCTGGGCTTTATG pLKO_005 13 5UTR 100% 13.200 9.240 N Jkamp n/a
6 TRCN0000174776 GAAATAGAGAACTGCTATGAT pLKO.1 531 CDS 100% 5.625 3.938 N Jkamp n/a
7 TRCN0000194371 CCTATGGCATAGTCTCCATCT pLKO.1 607 CDS 100% 4.050 2.835 N Jkamp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15847 pDONR223 0% 64.9% 71.4% None (many diffs) n/a
2 ccsbBroad304_15847 pLX_304 0% 64.9% 71.4% V5 (many diffs) n/a
3 TRCN0000472160 CACAAGCCATCTCGATCTTTACTA pLX_317 54.8% 64.9% 71.4% V5 (many diffs) n/a
4 ccsbBroadEn_08306 pDONR223 100% 63.6% 70% None (many diffs) n/a
5 ccsbBroad304_08306 pLX_304 0% 63.6% 70% V5 (many diffs) n/a
6 TRCN0000470832 AGCGCTGGTGTAGAATCACCATTC pLX_317 48.6% 63.6% 70% V5 (many diffs) n/a
Download CSV