Construct: ORF TRCN0000470832
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004772.1_s317c1
- Derived from:
- ccsbBroadEn_08306
- DNA Barcode:
- AGCGCTGGTGTAGAATCACCATTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- JKAMP (51528)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470832
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_016475.5 | 99.8% | 99.6% | 5C>G |
2 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001098625.2 | 98% | 97.7% | 3_4insGGTGTCGATATTCAACCA |
3 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284202.1 | 96.6% | 95.2% | (many diffs) |
4 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284201.1 | 95.5% | 95% | 1_33delinsA;38_47delTTTTGCTTAC |
5 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | XM_024449627.1 | 95.5% | 95% | 1_33delinsA;38_47delTTTTGCTTAC |
6 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284203.1 | 79.7% | 79.7% | 0_1ins189 |
7 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284204.1 | 68.3% | 68.1% | 5C>G;639_640ins294 |
8 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | XM_017021366.1 | 66.5% | 66.2% | 3_4insGGTGTCGATATTCAACCA;621_622ins294 |
9 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | XM_006720171.4 | 65.4% | 64.9% | 1_33delinsA;38_47delTTTTGCTTAC;681_682ins294 |
10 | mouse | 104771 | Jkamp | JNK1/MAPK8-associated membr... | NM_024205.2 | 87.7% | 97.7% | (many diffs) |
11 | mouse | 104771 | Jkamp | JNK1/MAPK8-associated membr... | NM_001205067.1 | 85.9% | 95.8% | (many diffs) |
12 | mouse | 104771 | Jkamp | JNK1/MAPK8-associated membr... | XM_017314927.1 | 63.6% | 70% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 999
- ORF length:
- 933
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tgtcgatatt caaccagcat gccttggact ttattgtggg aagaccctat 121 tatttaaaaa tggctcaact gaaatatatg gagaatgtgg ggtatgccca agaggacaga 181 gaacgaatgc acagaaatat tgtcagcctt gcacagaatc tcctgaactt tatgattggc 241 tctatcttgg atttatggca atgcttcctc tggttttaca ttggttcttc attgaatggt 301 actcggggaa aaagagttcc agcgcacttt tccaacacat cactgcatta tttgaatgca 361 gcatggcagc tattatcacc ttacttgtga gtgatccagt tggtgttctt tatattcgtt 421 catgtcgagt attgatgctt tctgactggt acacgatgct ttacaaccca agtccagatt 481 acgttaccac agtacactgt actcatgaag ccgtctaccc actatatacc attgtattta 541 tctatTACGC ATTCTGCTTG GTATTAATGA TGCTGCTCCG ACCTCTTCTG GTGAAGAAGA 601 TTGCATGTGG GTTAGGGAAA TCTGATCGAT TTAAAAGTAT TTATGCTGCA CTTTACTTCT 661 TCCCAATTTT AACCGTGCTT CAGGCAGTTG GTGGAGGCCT TTTATATTAC GCCTTCCCAT 721 ACATTATATT AGTGTTATCT TTGGTTACTC TGGCTGTGTA CATGTCTGCT TCTGAAATAG 781 AGAACTGCTA TGATCTTCTG GTCAGAAAGA AAAGACTTAT TGTTCTCTTC AGCCACTGGT 841 TACTTCATGC CTATGGAATA ATCTCCATTT CCAGAGTGGA TAAACTTGAG CAAGATTTGC 901 CCCTTTTGGC TTTGGTACCT ACACCAGCCC TTTTTTACTT GTTCACTGCA AAATTTACCG 961 AACCTTCAAG GATACTCTCA GAAGGAGCCA ATGGACACTG CCCAACTTTC TTGTACAAAG 1021 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1081 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1141 ACGAAGCGCT GGTGTAGAAT CACCATTCAC GCGTTAAGTC gacaatcaac ctctggatta 1201 caaaatttgt gaaagatt