Construct: ORF TRCN0000472160
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002030.1_s317c1
- Derived from:
- ccsbBroadEn_15847
- DNA Barcode:
- CACAAGCCATCTCGATCTTTACTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- JKAMP (51528)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472160
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001098625.2 | 100% | 100% | |
| 2 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_016475.5 | 98% | 97.7% | 4_21del |
| 3 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284202.1 | 95.5% | 94.9% | 1_33delinsA;37_46delGTTTTGCTTA |
| 4 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284201.1 | 93.4% | 93.5% | 1_62del;63_64insTG |
| 5 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | XM_024449627.1 | 93.4% | 93.5% | 1_62del;63_64insTG |
| 6 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284203.1 | 81.3% | 81.3% | 0_1ins171 |
| 7 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | XM_017021366.1 | 67.8% | 67.8% | 621_622ins294 |
| 8 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | NM_001284204.1 | 66.5% | 66.2% | 4_21del;639_640ins294 |
| 9 | human | 51528 | JKAMP | JNK1/MAPK8 associated membr... | XM_006720171.4 | 63.3% | 63.3% | 1_62del;63_64insTG;681_682ins294 |
| 10 | mouse | 104771 | Jkamp | JNK1/MAPK8-associated membr... | NM_001205067.1 | 87.6% | 98% | (many diffs) |
| 11 | mouse | 104771 | Jkamp | JNK1/MAPK8-associated membr... | NM_024205.2 | 85.9% | 95.8% | (many diffs) |
| 12 | mouse | 104771 | Jkamp | JNK1/MAPK8-associated membr... | XM_017314927.1 | 64.9% | 71.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 981
- ORF length:
- 915
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc atgccttgga ctttattgtg ggaagaccct attatttaaa aatggctcaa 121 ctgaaatata tggagaatgt ggggtatgcc caagaggaca gagaacgaat gcacagaaat 181 attgtcagcc ttgcacagaa tctcctgaac tttatgattg gctctatctt ggatttatgg 241 caatgcttcc tctggtttta cattggttct tcattgaatg gtactcgggg aaaaagagtt 301 ccagcgcact tttccaacac atcactgcat tatttgaatg cagcatggca gctattatca 361 ccttacttgt gagtgatcca gttggtgttc tttatattcg ttcatgtcga gtattgatgc 421 tttctgactg gtacacgatg ctttacaacc caagtccaga ttacgttacc acagtacaCT 481 GTACTCATGA AGCCGTCTAC CCACTATATA CCATTGTATT TATCTATTAC GCATTCTGCT 541 TGGTATTAAT GATGCTGCTC CGACCTCTTC TGGTGAAGAA GATTGCATGT GGGTTAGGGA 601 AATCTGATCG ATTTAAAAGT ATTTATGCTG CACTTTACTT CTTCCCAATT TTAACCGTGC 661 TTCAGGCAGT TGGTGGAGGC CTTTTATATT ACGCCTTCCC ATACATTATA TTAGTGTTAT 721 CTTTGGTTAC TCTGGCTGTG TACATGTCTG CTTCTGAAAT AGAGAACTGC TATGATCTTC 781 TGGTCAGAAA GAAAAGACTT ATTGTTCTCT TCAGCCACTG GTTACTTCAT GCCTATGGAA 841 TAATCTCCAT TTCCAGAGTG GATAAACTTG AGCAAGATTT GCCCCTTTTG GCTTTGGTAC 901 CTACACCAGC CCTTTTTTAC TTGTTCACTG CAAAATTTAC CGAACCTTCA AGGATACTCT 961 CAGAAGGAGC CAATGGACAC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1021 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1081 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACACA AGCCATCTCG 1141 ATCTTTACTA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt