Transcript: Mouse XM_017314994.1

PREDICTED: Mus musculus poly (A) polymerase alpha (Papola), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Papola (18789)
Length:
4476
CDS:
234..2387

Additional Resources:

NCBI RefSeq record:
XM_017314994.1
NBCI Gene record:
Papola (18789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193635 CAACAGAAGGAGTCAAGTTAA pLKO.1 1759 CDS 100% 13.200 9.240 N Papola n/a
2 TRCN0000297626 GCGAAGCCAGGAGTGCTATTA pLKO_005 2585 3UTR 100% 13.200 9.240 N Papola n/a
3 TRCN0000279187 TTGCAGGGTAACCGATGAAAT pLKO_005 842 CDS 100% 13.200 9.240 N Papola n/a
4 TRCN0000175526 CTATTGAAACAGCCTGAAGAA pLKO.1 1089 CDS 100% 4.950 3.465 N Papola n/a
5 TRCN0000279185 CTATTGAAACAGCCTGAAGAA pLKO_005 1089 CDS 100% 4.950 3.465 N Papola n/a
6 TRCN0000193948 GTCAAGTTAACAGCTCTGAAT pLKO.1 1770 CDS 100% 4.950 3.465 N Papola n/a
7 TRCN0000279116 GTCAAGTTAACAGCTCTGAAT pLKO_005 1770 CDS 100% 4.950 3.465 N Papola n/a
8 TRCN0000173483 GAAGAGGCATTTGTACCAGTT pLKO.1 681 CDS 100% 4.050 2.835 N Papola n/a
9 TRCN0000279117 GAAGAGGCATTTGTACCAGTT pLKO_005 681 CDS 100% 4.050 2.835 N Papola n/a
10 TRCN0000053018 CCACGTACAATGTGTCCGTTT pLKO.1 1207 CDS 100% 4.050 2.430 N PAPOLA n/a
11 TRCN0000294191 ACCATCTTATGCCTATAATTA pLKO_005 1162 CDS 100% 15.000 7.500 Y PAPOLA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314994.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08657 pDONR223 100% 75.3% 74.1% None (many diffs) n/a
2 ccsbBroad304_08657 pLX_304 0% 75.3% 74.1% V5 (many diffs) n/a
3 TRCN0000468084 CTTTTCATCAAGCTAGGAGATCAC pLX_317 24.9% 75.3% 74.1% V5 (many diffs) n/a
4 ccsbBroadEn_11570 pDONR223 100% 36.9% 38.4% None (many diffs) n/a
5 TRCN0000479225 GTACAGGTACTCAAGTAGGGTTCA pLX_317 64.1% 36.9% 38.4% V5 (many diffs) n/a
Download CSV