Transcript: Mouse XM_017315004.1

PREDICTED: Mus musculus grainyhead-like 1 (Drosophila) (Grhl1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grhl1 (195733)
Length:
3441
CDS:
810..1982

Additional Resources:

NCBI RefSeq record:
XM_017315004.1
NBCI Gene record:
Grhl1 (195733)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420859 CATTGAGGAGATAGCTTATAA pLKO_005 1175 CDS 100% 15.000 21.000 N Grhl1 n/a
2 TRCN0000084243 CCCTCAGCAATAAAGGGCTAA pLKO.1 2415 3UTR 100% 4.050 5.670 N Grhl1 n/a
3 TRCN0000084245 GCTCACCCTGACAGAGATTTA pLKO.1 1961 CDS 100% 13.200 9.240 N Grhl1 n/a
4 TRCN0000412741 ATCTGACAGCTCCCGATACAA pLKO_005 612 5UTR 100% 5.625 3.938 N Grhl1 n/a
5 TRCN0000084246 GAGGCAATTTCAGACAAGTAT pLKO.1 1797 CDS 100% 5.625 3.938 N Grhl1 n/a
6 TRCN0000084244 CCTGAATAAAGGCCAGTTCTA pLKO.1 944 CDS 100% 4.950 3.465 N Grhl1 n/a
7 TRCN0000084247 CGACAACATTGTGAAGCACTA pLKO.1 1886 CDS 100% 4.050 2.835 N Grhl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315004.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08126 pDONR223 100% 55.2% 57.9% None (many diffs) n/a
2 ccsbBroad304_08126 pLX_304 0% 55.2% 57.9% V5 (many diffs) n/a
3 TRCN0000478144 ACGGGGGCGGTTGAACCTTCTGTA pLX_317 12.1% 55.2% 57.9% V5 (many diffs) n/a
Download CSV