Transcript: Mouse XM_017315158.1

PREDICTED: Mus musculus neuro-oncological ventral antigen 1 (Nova1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nova1 (664883)
Length:
3814
CDS:
583..1740

Additional Resources:

NCBI RefSeq record:
XM_017315158.1
NBCI Gene record:
Nova1 (664883)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001092 TCTATAATTGGGAAGGGAGGA pLKO.1 301 5UTR 100% 2.160 1.512 N NOVA1 n/a
2 TRCN0000001090 TACCTAGTTATGCTGCTGGAT pLKO.1 281 5UTR 100% 0.000 0.000 N NOVA1 n/a
3 TRCN0000001091 ACCAAGTCCTCTCCATCTGAT pLKO.1 688 CDS 100% 4.950 3.465 N NOVA1 n/a
4 TRCN0000272892 ACCAAGTCCTCTCCATCTGAT pLKO_005 688 CDS 100% 4.950 3.465 N NOVA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01104 pDONR223 100% 73.7% 75.7% None (many diffs) n/a
2 ccsbBroad304_01104 pLX_304 0% 73.7% 75.7% V5 (many diffs) n/a
3 TRCN0000477424 TTTCTAACGGATTCCAGACATCCC pLX_317 21.6% 73.7% 75.7% V5 (many diffs) n/a
Download CSV