Transcript: Mouse XM_017315169.1

PREDICTED: Mus musculus echinoderm microtubule associated protein like 1 (Eml1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eml1 (68519)
Length:
3903
CDS:
18..2555

Additional Resources:

NCBI RefSeq record:
XM_017315169.1
NBCI Gene record:
Eml1 (68519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090315 CCAAGTGGATTCGTACAGTTT pLKO.1 716 CDS 100% 4.950 6.930 N Eml1 n/a
2 TRCN0000090316 GCATCTACATATATGGAGTTA pLKO.1 2053 CDS 100% 4.950 6.930 N Eml1 n/a
3 TRCN0000090313 CGGATCTTTAAATAGAGGAAT pLKO.1 3629 3UTR 100% 4.950 3.960 N Eml1 n/a
4 TRCN0000090314 CCCTAGAAGGAAATTCCCTTA pLKO.1 1303 CDS 100% 4.050 2.835 N Eml1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315169.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06157 pDONR223 100% 82.7% 90.7% None (many diffs) n/a
2 ccsbBroad304_06157 pLX_304 0% 82.7% 90.7% V5 (many diffs) n/a
3 TRCN0000481317 AAGGGGCAAGAAATCACCGCTTGG pLX_317 21.7% 82.7% 90.7% V5 (many diffs) n/a
4 ccsbBroadEn_15408 pDONR223 0% 82.7% 90.5% None (many diffs) n/a
5 ccsbBroad304_15408 pLX_304 0% 82.7% 90.5% V5 (many diffs) n/a
6 TRCN0000470010 GGGCTTCAACTTGAAAGATACATT pLX_317 15% 82.7% 90.5% V5 (many diffs) n/a
Download CSV