Transcript: Mouse XM_017315327.1

PREDICTED: Mus musculus predicted gene 2046 (Gm2046), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm2046 (100039100)
Length:
767
CDS:
377..760

Additional Resources:

NCBI RefSeq record:
XM_017315327.1
NBCI Gene record:
Gm2046 (100039100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315327.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256191 TAAGGAGGCTGTGCCACATAA pLKO_005 540 CDS 100% 13.200 6.600 Y Gm2016 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315327.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02077 pDONR223 100% 77.3% 78.4% None (many diffs) n/a
2 ccsbBroad304_02077 pLX_304 0% 77.3% 78.4% V5 (many diffs) n/a
3 TRCN0000466671 CTTCCACCAGTTATAATCCAACTC pLX_317 57.7% 77.3% 78.4% V5 (many diffs) n/a
4 ccsbBroadEn_06145 pDONR223 100% 74.3% 78.4% None (many diffs) n/a
5 ccsbBroad304_06145 pLX_304 0% 74.3% 78.4% V5 (many diffs) n/a
6 TRCN0000475064 CCTGTTCTTTCTGAACACCACATC pLX_317 100% 74.3% 78.4% V5 (many diffs) n/a
Download CSV