Transcript: Mouse XM_017315564.1

PREDICTED: Mus musculus exocyst complex component 2 (Exoc2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Exoc2 (66482)
Length:
2966
CDS:
320..2737

Additional Resources:

NCBI RefSeq record:
XM_017315564.1
NBCI Gene record:
Exoc2 (66482)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195832 CGCAGGCTACTTTGATTGGAA pLKO.1 2659 CDS 100% 3.000 4.200 N Exoc2 n/a
2 TRCN0000179234 GCCGAAGAGATAAAGAGATTA pLKO.1 2102 CDS 100% 13.200 9.240 N Exoc2 n/a
3 TRCN0000180377 GCCTGGTATCTCATAGAGAAT pLKO.1 821 CDS 100% 4.950 3.465 N Exoc2 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2937 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03652 pDONR223 100% 76.3% 80.8% None (many diffs) n/a
2 ccsbBroad304_03652 pLX_304 0% 76.3% 80.8% V5 (many diffs) n/a
3 TRCN0000478826 TGGTCAGTCATACAACAGGCAGAC pLX_317 15.2% 76.3% 80.8% V5 (many diffs) n/a
Download CSV