Transcript: Mouse XM_017315582.1

PREDICTED: Mus musculus family with sequence similarity 172, member A (Fam172a), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam172a (68675)
Length:
791
CDS:
8..697

Additional Resources:

NCBI RefSeq record:
XM_017315582.1
NBCI Gene record:
Fam172a (68675)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346939 GTGGGCTAGAAGGCTTATTAT pLKO_005 562 CDS 100% 15.000 21.000 N Fam172a n/a
2 TRCN0000346938 TTTGCTGTCTAGGATCGATTT pLKO_005 178 CDS 100% 10.800 8.640 N Fam172a n/a
3 TRCN0000347007 GGCGAGATCATCACAAGATAT pLKO_005 374 CDS 100% 13.200 9.240 N Fam172a n/a
4 TRCN0000147818 GCTTTGACAAATCCACAGAAA pLKO.1 497 CDS 100% 4.950 2.970 N FAM172A n/a
5 TRCN0000352960 GCTTTGACAAATCCACAGAAA pLKO_005 497 CDS 100% 4.950 2.970 N FAM172A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04314 pDONR223 100% 38.8% 36.3% None (many diffs) n/a
2 ccsbBroad304_04314 pLX_304 0% 38.8% 36.3% V5 (many diffs) n/a
3 TRCN0000479117 CGCCGGTCCCAGCCCATAGAACCT pLX_317 34.4% 38.8% 36.3% V5 (many diffs) n/a
Download CSV