Transcript: Mouse XM_017315913.1

PREDICTED: Mus musculus orthodenticle homeobox 2 (Otx2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Otx2 (18424)
Length:
2263
CDS:
341..1234

Additional Resources:

NCBI RefSeq record:
XM_017315913.1
NBCI Gene record:
Otx2 (18424)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429876 CAGACTCCTGATCAAAGTTAC pLKO_005 1339 3UTR 100% 10.800 15.120 N Otx2 n/a
2 TRCN0000420017 TCTAGCGACATGCAACCAAAT pLKO_005 1503 3UTR 100% 10.800 15.120 N Otx2 n/a
3 TRCN0000015612 CCATGACCTATACTCAGGCTT pLKO.1 891 CDS 100% 2.640 3.696 N OTX2 n/a
4 TRCN0000174495 CCTGATTTGCAAATGATTGAT pLKO.1 1473 3UTR 100% 5.625 4.500 N Otx2 n/a
5 TRCN0000176356 CCACTGATTGCTTGGATTATA pLKO.1 1122 CDS 100% 15.000 10.500 N Otx2 n/a
6 TRCN0000438502 AGGGTGCAGGTATGGTTTAAG pLKO_005 605 CDS 100% 13.200 9.240 N Otx2 n/a
7 TRCN0000194547 GCATGGACTGTGGATCTTATT pLKO.1 957 CDS 100% 13.200 9.240 N Otx2 n/a
8 TRCN0000443129 ACGTTCTGGAAGCTCTGTTTG pLKO_005 516 CDS 100% 10.800 7.560 N Otx2 n/a
9 TRCN0000015611 GCTGGCTCAACTTCCTACTTT pLKO.1 932 CDS 100% 5.625 3.938 N OTX2 n/a
10 TRCN0000175734 GCTGACTGCTTGGATTATAAA pLKO.1 1178 CDS 100% 15.000 9.000 N Otx2 n/a
11 TRCN0000424437 CATCAACCAGCAACCTGAAAT pLKO_005 1402 3UTR 100% 13.200 7.920 N Otx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315913.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01128 pDONR223 100% 94.8% 99.3% None (many diffs) n/a
2 ccsbBroad304_01128 pLX_304 0% 94.8% 99.3% V5 (many diffs) n/a
3 TRCN0000472658 TCCGCACGCTCGAAAAAACGTCGT pLX_317 51.2% 94.8% 99.3% V5 (many diffs) n/a
Download CSV