Transcript: Mouse XM_017316184.1

PREDICTED: Mus musculus transmembrane and tetratricopeptide repeat containing 4 (Tmtc4), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmtc4 (70551)
Length:
3163
CDS:
565..2139

Additional Resources:

NCBI RefSeq record:
XM_017316184.1
NBCI Gene record:
Tmtc4 (70551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151358 GCTAAGGTTCACTACAACATT pLKO.1 1357 CDS 100% 5.625 7.875 N TMTC4 n/a
2 TRCN0000216948 CGTGGAACAACATGATCATAC pLKO.1 1772 CDS 100% 10.800 7.560 N Tmtc4 n/a
3 TRCN0000151438 GCTTTATTCCTCAAGGCAATT pLKO.1 1930 CDS 100% 10.800 7.560 N TMTC4 n/a
4 TRCN0000178142 GCAACAGTGTAACTTGAAGTT pLKO.1 2588 3UTR 100% 4.950 3.465 N Tmtc4 n/a
5 TRCN0000293092 GCAACAGTGTAACTTGAAGTT pLKO_005 2588 3UTR 100% 4.950 3.465 N Tmtc4 n/a
6 TRCN0000198394 GCAGGATAATATTCCACTGTT pLKO.1 2778 3UTR 100% 4.950 3.465 N Tmtc4 n/a
7 TRCN0000198966 GCGATTAAACACAGGAGGAAA pLKO.1 1639 CDS 100% 4.950 3.465 N Tmtc4 n/a
8 TRCN0000177772 CCTTATGTTCTCATTGGCAAA pLKO.1 1872 CDS 100% 4.050 2.835 N Tmtc4 n/a
9 TRCN0000293093 CCTTATGTTCTCATTGGCAAA pLKO_005 1872 CDS 100% 4.050 2.835 N Tmtc4 n/a
10 TRCN0000182467 GCCATGAATAACCTCGGGAAT pLKO.1 1465 CDS 100% 4.050 2.835 N Tmtc4 n/a
11 TRCN0000293094 GCCATGAATAACCTCGGGAAT pLKO_005 1465 CDS 100% 4.050 2.835 N Tmtc4 n/a
12 TRCN0000151284 CTGAGAAGAAAGCTAGAACTA pLKO.1 2098 CDS 100% 4.950 3.465 N TMTC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316184.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14318 pDONR223 100% 64.4% 62.8% None (many diffs) n/a
2 ccsbBroad304_14318 pLX_304 0% 64.4% 62.8% V5 (many diffs) n/a
3 TRCN0000478510 TTTTGAGCACGAAAAGTAATTTTG pLX_317 25.8% 64.4% 62.8% V5 (many diffs) n/a
Download CSV