Transcript: Mouse XM_017316416.1

PREDICTED: Mus musculus calcium channel, voltage-dependent, beta 3 subunit (Cacnb3), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cacnb3 (12297)
Length:
2324
CDS:
108..1556

Additional Resources:

NCBI RefSeq record:
XM_017316416.1
NBCI Gene record:
Cacnb3 (12297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069129 GCGCTCTTCGACTTCCTTAAA pLKO.1 696 CDS 100% 13.200 18.480 N Cacnb3 n/a
2 TRCN0000318146 GCGCTCTTCGACTTCCTTAAA pLKO_005 696 CDS 100% 13.200 18.480 N Cacnb3 n/a
3 TRCN0000069130 CTGGCTGAATACTTAGAGGTT pLKO.1 1146 CDS 100% 2.640 3.696 N Cacnb3 n/a
4 TRCN0000318148 CTGGCTGAATACTTAGAGGTT pLKO_005 1146 CDS 100% 2.640 3.696 N Cacnb3 n/a
5 TRCN0000069128 CCCTTGCTCTTCTCATTCTTT pLKO.1 2253 3UTR 100% 5.625 3.938 N Cacnb3 n/a
6 TRCN0000318149 CCCTTGCTCTTCTCATTCTTT pLKO_005 2253 3UTR 100% 5.625 3.938 N Cacnb3 n/a
7 TRCN0000069131 GCATTTGCTGTGAGGACCAAT pLKO.1 285 CDS 100% 4.950 3.465 N Cacnb3 n/a
8 TRCN0000318073 GCATTTGCTGTGAGGACCAAT pLKO_005 285 CDS 100% 4.950 3.465 N Cacnb3 n/a
9 TRCN0000069132 GCTGAAGTGCAGAGTGAGATT pLKO.1 843 CDS 100% 4.950 3.465 N Cacnb3 n/a
10 TRCN0000318147 GCTGAAGTGCAGAGTGAGATT pLKO_005 843 CDS 100% 4.950 3.465 N Cacnb3 n/a
11 TRCN0000044065 TGGAGTCAACTTTGAGGCCAA pLKO.1 353 CDS 100% 2.160 1.512 N CACNB3 n/a
12 TRCN0000044064 CCCATCATCGTCTTTGTCAAA pLKO.1 960 CDS 100% 4.950 2.970 N CACNB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05925 pDONR223 100% 91% 95.5% None (many diffs) n/a
2 ccsbBroad304_05925 pLX_304 0% 91% 95.5% V5 (many diffs) n/a
3 TRCN0000476911 CTGCCCCGCTGACCGATGTCCGAT pLX_317 23.6% 91% 95.5% V5 (many diffs) n/a
Download CSV