Transcript: Mouse XM_017316718.1

PREDICTED: Mus musculus solute carrier family 4 (anion exchanger), member 8 (Slc4a8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc4a8 (59033)
Length:
11557
CDS:
106..3219

Additional Resources:

NCBI RefSeq record:
XM_017316718.1
NBCI Gene record:
Slc4a8 (59033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069915 CCAGCACCTTAAAGACATTTA pLKO.1 2069 CDS 100% 13.200 18.480 N Slc4a8 n/a
2 TRCN0000069913 CCCGTTCTTGGTCATCTCAAA pLKO.1 3325 3UTR 100% 4.950 6.930 N Slc4a8 n/a
3 TRCN0000069914 CCTGATTTGTATCATCTTCAT pLKO.1 1740 CDS 100% 4.950 3.960 N Slc4a8 n/a
4 TRCN0000069917 CGCTGTCATCATTAACAGGAA pLKO.1 2355 CDS 100% 2.640 2.112 N Slc4a8 n/a
5 TRCN0000069916 GCTTATGATCTTCGTGCTGAT pLKO.1 2589 CDS 100% 4.050 2.835 N Slc4a8 n/a
6 TRCN0000043182 GCCTCTATTACTGCAGGTGTA pLKO.1 1838 CDS 100% 4.050 2.430 N SLC4A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11376 pDONR223 100% 50.5% 54% None (many diffs) n/a
2 ccsbBroad304_11376 pLX_304 0% 50.5% 54% V5 (many diffs) n/a
3 TRCN0000479470 ACCGACTGCAGAGTCTGTATAGTC pLX_317 19.1% 50.5% 54% V5 (many diffs) n/a
Download CSV