Transcript: Mouse XM_017316829.1

PREDICTED: Mus musculus signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 (Stam), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stam (20844)
Length:
3265
CDS:
709..2205

Additional Resources:

NCBI RefSeq record:
XM_017316829.1
NBCI Gene record:
Stam (20844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382506 GGATAATGAGCTTACCTTTAA pLKO_005 1233 CDS 100% 13.200 18.480 N Stam n/a
2 TRCN0000340135 TCTCACTGTATACGAAGTTAA pLKO_005 1661 CDS 100% 13.200 18.480 N Stam n/a
3 TRCN0000175141 GAAGATTTAGCCAAAGCTATT pLKO.1 1078 CDS 100% 10.800 15.120 N Stam n/a
4 TRCN0000340133 GAAGATTTAGCCAAAGCTATT pLKO_005 1078 CDS 100% 10.800 15.120 N Stam n/a
5 TRCN0000175140 GCTGGAAGATATTGATAGAAA pLKO.1 1596 CDS 100% 5.625 7.875 N Stam n/a
6 TRCN0000375714 CCTGCTGATGTCACCATATAC pLKO_005 2056 CDS 100% 13.200 9.240 N Stam n/a
7 TRCN0000381432 TCAGCCACAGCAAGCATATTC pLKO_005 2166 CDS 100% 13.200 9.240 N Stam n/a
8 TRCN0000381165 TCTCTGCTTCCCAGGTATATC pLKO_005 1754 CDS 100% 13.200 9.240 N Stam n/a
9 TRCN0000380728 GCAATGATCAAGAACCTTAAG pLKO_005 946 CDS 100% 10.800 7.560 N Stam n/a
10 TRCN0000004063 TGTGTATCAAACTGTGGCAAA pLKO.1 772 CDS 100% 4.050 2.835 N STAM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11252 pDONR223 100% 58% 60.4% None (many diffs) n/a
2 ccsbBroad304_11252 pLX_304 0% 58% 60.4% V5 (many diffs) n/a
3 TRCN0000469240 GAGCGTTCGCCGCTAGAAAAAAAA pLX_317 30.1% 58% 60.4% V5 (many diffs) n/a
Download CSV