Transcript: Mouse XM_017316880.1

PREDICTED: Mus musculus glutamate receptor, ionotropic, kainate 1 (Grik1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grik1 (14805)
Length:
3483
CDS:
898..3189

Additional Resources:

NCBI RefSeq record:
XM_017316880.1
NBCI Gene record:
Grik1 (14805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446313 CACACCCTACGAGTGGTATAA pLKO_005 2223 CDS 100% 13.200 10.560 N Grik1 n/a
2 TRCN0000428923 CCTGCAGTGCCATCGACATAA pLKO_005 1506 CDS 100% 13.200 9.240 N Grik1 n/a
3 TRCN0000100308 CCTGGACATTATCAGTCTCAA pLKO.1 1638 CDS 100% 4.950 3.465 N Grik1 n/a
4 TRCN0000100309 GACCAGAATAGTTGGAGGAAT pLKO.1 2367 CDS 100% 4.950 3.465 N Grik1 n/a
5 TRCN0000100306 GCTGCCTTCTTGACAGTAGAA pLKO.1 2437 CDS 100% 4.950 3.465 N Grik1 n/a
6 TRCN0000063152 GCTTTGGATCTGGAACTCTAT pLKO.1 1261 CDS 100% 4.950 3.465 N GRIK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316880.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.