Transcript: Mouse XM_017316887.1

PREDICTED: Mus musculus mahogunin, ring finger 1 (Mgrn1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgrn1 (17237)
Length:
2520
CDS:
282..1946

Additional Resources:

NCBI RefSeq record:
XM_017316887.1
NBCI Gene record:
Mgrn1 (17237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039465 GCCTTCTTTCAAGATTGACTT pLKO.1 800 CDS 100% 4.950 6.930 N Mgrn1 n/a
2 TRCN0000033792 CGGAAACTACTTTGCTTCGCA pLKO.1 368 CDS 100% 0.750 1.050 N MGRN1 n/a
3 TRCN0000333019 CGGAAACTACTTTGCTTCGCA pLKO_005 368 CDS 100% 0.750 1.050 N MGRN1 n/a
4 TRCN0000039466 GAAACTACTTTGCTTCGCATT pLKO.1 370 CDS 100% 4.050 3.240 N Mgrn1 n/a
5 TRCN0000039467 CGGCATCGAGAACAAGAACAA pLKO.1 1043 CDS 100% 4.950 3.465 N Mgrn1 n/a
6 TRCN0000039468 CGTGCTCTACAGTCTGGAATT pLKO.1 626 CDS 100% 0.000 0.000 N Mgrn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316887.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02747 pDONR223 100% 82% 85% None (many diffs) n/a
2 ccsbBroad304_02747 pLX_304 0% 82% 85% V5 (many diffs) n/a
3 TRCN0000466993 CTGAGGTAACTTTCACCTCCACCT pLX_317 20.8% 82% 85% V5 (many diffs) n/a
Download CSV