Transcript: Mouse XM_017316932.1

PREDICTED: Mus musculus thrombopoietin (Thpo), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Thpo (21832)
Length:
1603
CDS:
509..1564

Additional Resources:

NCBI RefSeq record:
XM_017316932.1
NBCI Gene record:
Thpo (21832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066846 CCCTTTGTCTATCCCTGTTCT pLKO.1 1219 CDS 100% 4.950 3.465 N Thpo n/a
2 TRCN0000301815 CCCTTTGTCTATCCCTGTTCT pLKO_005 1219 CDS 100% 4.950 3.465 N Thpo n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01668 pDONR223 100% 22.4% 21.6% None (many diffs) n/a
2 ccsbBroad304_01668 pLX_304 0% 22.4% 21.6% V5 (many diffs) n/a
3 TRCN0000480742 CATGCGGCTCTGCCTTACAATGCG pLX_317 35.3% 22.4% 21.6% V5 (many diffs) n/a
Download CSV