Transcript: Mouse XM_017317115.1

PREDICTED: Mus musculus cms small ribosomal subunit 1 (Cmss1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cmss1 (66497)
Length:
975
CDS:
58..792

Additional Resources:

NCBI RefSeq record:
XM_017317115.1
NBCI Gene record:
Cmss1 (66497)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103634 CCGTTCCGTGATAGAATTAGA pLKO.1 270 CDS 100% 5.625 7.875 N Cmss1 n/a
2 TRCN0000103632 CGTTCCGTGATAGAATTAGAA pLKO.1 271 CDS 100% 5.625 7.875 N Cmss1 n/a
3 TRCN0000103633 GCTTCTAGATATGGGAGTGTT pLKO.1 729 CDS 100% 4.950 3.465 N Cmss1 n/a
4 TRCN0000103631 GCTGAGGAGAATGATGGACAT pLKO.1 681 CDS 100% 4.050 2.835 N Cmss1 n/a
5 TRCN0000103630 GTCCTGATGAAGAGTCCAGTT pLKO.1 799 3UTR 100% 4.050 2.835 N Cmss1 n/a
6 TRCN0000072721 CCCGAGATAAGAAAGGAGGTA pLKO.1 703 CDS 100% 2.640 3.696 N CMSS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09181 pDONR223 100% 74.4% 72.8% None (many diffs) n/a
2 ccsbBroad304_09181 pLX_304 0% 74.4% 72.8% V5 (many diffs) n/a
3 TRCN0000470967 AAACATAAGTACGGTTAACTCGCA pLX_317 30.8% 74.4% 72.8% V5 (many diffs) n/a
Download CSV