Transcript: Mouse XM_017317135.1

PREDICTED: Mus musculus apoptosis-inducing factor, mitochondrion-associated 3 (Aifm3), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aifm3 (72168)
Length:
2285
CDS:
611..2200

Additional Resources:

NCBI RefSeq record:
XM_017317135.1
NBCI Gene record:
Aifm3 (72168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176611 CATAAGTTCCAGGTGAAGATT pLKO.1 1064 CDS 100% 5.625 3.938 N Aifm3 n/a
2 TRCN0000178004 GCTGCTTATCTGACTGAGAAA pLKO.1 1652 CDS 100% 4.950 3.465 N Aifm3 n/a
3 TRCN0000064546 GCCAAGTGTATCTCTCCAAGT pLKO.1 1154 CDS 100% 4.050 2.835 N AIFM3 n/a
4 TRCN0000177259 GAGAAATAAGAAGGTTGTGTT pLKO.1 1435 CDS 100% 4.950 2.970 N Aifm3 n/a
5 TRCN0000064545 AGCATGAACTACGATCCCATT pLKO.1 2212 3UTR 100% 4.050 2.835 N AIFM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05035 pDONR223 100% 77.5% 84.1% None (many diffs) n/a
2 ccsbBroad304_05035 pLX_304 0% 77.5% 84.1% V5 (many diffs) n/a
3 TRCN0000479715 CGTACGGTCAGCTAATTACAACCC pLX_317 18.3% 77.5% 84.1% V5 (many diffs) n/a
Download CSV