Transcript: Mouse XM_017317683.1

PREDICTED: Mus musculus solute carrier family 25, member 27 (Slc25a27), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc25a27 (74011)
Length:
10939
CDS:
3131..3811

Additional Resources:

NCBI RefSeq record:
XM_017317683.1
NBCI Gene record:
Slc25a27 (74011)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432983 CACCGCTTGAAGACAATATTT pLKO_005 3480 CDS 100% 15.000 21.000 N Slc25a27 n/a
2 TRCN0000068987 GCAGGCTGGATACCCAATATT pLKO.1 3386 CDS 100% 15.000 21.000 N Slc25a27 n/a
3 TRCN0000068984 CGTGGAGTACATCATGCATTT pLKO.1 3326 CDS 100% 10.800 7.560 N Slc25a27 n/a
4 TRCN0000434567 GTGAAACACTACCTGGTATTG pLKO_005 3455 CDS 100% 10.800 7.560 N Slc25a27 n/a
5 TRCN0000068983 CCCTGTTATTTCTACCTCTTT pLKO.1 7187 3UTR 100% 4.950 3.465 N Slc25a27 n/a
6 TRCN0000068985 CGGATGGTCACCTATGAACAT pLKO.1 3128 5UTR 100% 4.950 3.465 N Slc25a27 n/a
7 TRCN0000068986 CTGAGCCTGTATAAAGGCTTT pLKO.1 3674 CDS 100% 0.405 0.284 N Slc25a27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11373 pDONR223 100% 36.8% 38.3% None (many diffs) n/a
2 ccsbBroad304_11373 pLX_304 0% 36.8% 38.3% V5 (many diffs) n/a
3 TRCN0000480941 CCACAACAACTAAGACATCGCGAA pLX_317 52.3% 36.8% 38.3% V5 (many diffs) n/a
Download CSV