Transcript: Mouse XM_017317723.1

PREDICTED: Mus musculus CREB3 regulatory factor (Crebrf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Crebrf (77128)
Length:
9777
CDS:
2625..4547

Additional Resources:

NCBI RefSeq record:
XM_017317723.1
NBCI Gene record:
Crebrf (77128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431955 AGACCAACATGTATCATAATG pLKO_005 3274 CDS 100% 13.200 18.480 N CREBRF n/a
2 TRCN0000191026 CTGGATAGAGAGATGAATTAT pLKO.1 2757 CDS 100% 15.000 10.500 N Crebrf n/a
3 TRCN0000217097 CGAGATACCTTGCCAAGTAAT pLKO.1 3996 CDS 100% 13.200 9.240 N Crebrf n/a
4 TRCN0000172560 GCTGGGCAAACCTCAGAATTT pLKO.1 4443 CDS 100% 13.200 9.240 N CREBRF n/a
5 TRCN0000200506 CTGTGAAGACTTAACTAAGTA pLKO.1 2906 CDS 100% 5.625 3.938 N Crebrf n/a
6 TRCN0000191827 GCTTACATGATACTGTATGAA pLKO.1 5513 3UTR 100% 5.625 3.938 N Crebrf n/a
7 TRCN0000200932 CCAACAGTTCTGATCCAGATT pLKO.1 2725 CDS 100% 4.950 3.465 N Crebrf n/a
8 TRCN0000191700 CTCAACACTGAATATGACAAT pLKO.1 4293 CDS 100% 4.950 3.465 N Crebrf n/a
9 TRCN0000192993 GCATACTCTTTGTGCCTTGTA pLKO.1 5130 3UTR 100% 4.950 3.465 N Crebrf n/a
10 TRCN0000202399 GCTGAGTGTTAAGGTGGGTTT pLKO.1 4853 3UTR 100% 4.050 2.835 N Crebrf n/a
11 TRCN0000435351 AGAAGCTTGAAATCCTCATTA pLKO_005 4399 CDS 100% 13.200 7.920 N CREBRF n/a
12 TRCN0000189583 CCATCATCAGACTGTGTCCAA pLKO.1 3213 CDS 100% 2.640 1.584 N Crebrf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09694 pDONR223 100% 89.6% 93.5% None (many diffs) n/a
2 ccsbBroad304_09694 pLX_304 0% 89.6% 93.5% V5 (many diffs) n/a
3 TRCN0000479310 TAACTTGGCACGGGCCATGCGCCC pLX_317 23.5% 89.6% 93.5% V5 (many diffs) n/a
Download CSV