Transcript: Mouse XM_017317800.1

PREDICTED: Mus musculus CUGBP, Elav-like family member 4 (Celf4), transcript variant X43, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Celf4 (108013)
Length:
4013
CDS:
536..1879

Additional Resources:

NCBI RefSeq record:
XM_017317800.1
NBCI Gene record:
Celf4 (108013)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098603 GCCGCCATCAACGCTCTACAT pLKO.1 1124 CDS 100% 1.650 1.320 N Celf4 n/a
2 TRCN0000098601 CCGGGCATATGAACGGATTAA pLKO.1 624 CDS 100% 0.000 0.000 N Celf4 n/a
3 TRCN0000098602 CTGCTGCCTATGGTCAGATTA pLKO.1 1680 CDS 100% 13.200 9.240 N Celf4 n/a
4 TRCN0000098600 CCTTTGACATATCAGCCAATA pLKO.1 2001 3UTR 100% 10.800 7.560 N Celf4 n/a
5 TRCN0000074403 GATGCCATCAAGCTGTTCATT pLKO.1 689 CDS 100% 5.625 3.938 N CELF4 n/a
6 TRCN0000074407 CAAGCTGTTCATTGGGCAGAT pLKO.1 697 CDS 100% 4.050 2.835 N CELF4 n/a
7 TRCN0000437506 GTGCGCCTTTGTGAAGTACTC pLKO_005 1084 CDS 100% 4.050 2.835 N CELF4 n/a
8 TRCN0000074404 CTGCTGCCTATGGTCAGATAA pLKO.1 1680 CDS 100% 13.200 9.240 N CELF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12306 pDONR223 100% 87.8% 91.5% None (many diffs) n/a
2 ccsbBroad304_12306 pLX_304 0% 87.8% 91.5% V5 (many diffs) n/a
3 TRCN0000475751 TGGTAACTGTAACCCGAGGTCTCG pLX_317 17.5% 87.8% 91.5% V5 (many diffs) n/a
Download CSV