Transcript: Mouse XM_017317914.1

PREDICTED: Mus musculus thioredoxin-like 4A (Txnl4a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Txnl4a (27366)
Length:
795
CDS:
388..603

Additional Resources:

NCBI RefSeq record:
XM_017317914.1
NBCI Gene record:
Txnl4a (27366)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123685 GCAAGAAATGGTTGACATCAT pLKO.1 501 CDS 100% 4.950 3.960 N Txnl4a n/a
2 TRCN0000123687 CAAGCAAGAAATGGTTGACAT pLKO.1 498 CDS 100% 4.950 3.465 N Txnl4a n/a
3 TRCN0000123686 GCCTGACTTCAACAAGATGTA pLKO.1 372 5UTR 100% 4.950 3.465 N Txnl4a n/a
4 TRCN0000123688 GAAGACAAGCAAGAAATGGTT pLKO.1 493 CDS 100% 3.000 2.100 N Txnl4a n/a
5 TRCN0000064066 GCAGTTATTTATCTTGTGGAT pLKO.1 340 5UTR 100% 2.640 1.848 N TXNL4A n/a
6 TRCN0000064065 ACTGGCAACAACAACAAGATT pLKO.1 460 CDS 100% 5.625 3.938 N TXNL4A n/a
7 TRCN0000311673 ACTGGCAACAACAACAAGATT pLKO_005 460 CDS 100% 5.625 3.938 N TXNL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02555 pDONR223 100% 43.1% 50% None (many diffs) n/a
2 ccsbBroad304_02555 pLX_304 0% 43.1% 50% V5 (many diffs) n/a
3 TRCN0000467428 ACCCGCCTCTGCCGCGGTAATACA pLX_317 73.9% 43.1% 50% V5 (many diffs) n/a
Download CSV