Transcript: Mouse XM_017317922.1

PREDICTED: Mus musculus nucleolar protein 4 (Nol4), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nol4 (319211)
Length:
5185
CDS:
2140..3396

Additional Resources:

NCBI RefSeq record:
XM_017317922.1
NBCI Gene record:
Nol4 (319211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127175 GCTCAATAGAAAGTGACGAAT pLKO.1 2321 CDS 100% 4.950 3.960 N Nol4 n/a
2 TRCN0000127174 GCCTGGATATTCTTAATTCAA pLKO.1 3666 3UTR 100% 5.625 3.938 N Nol4 n/a
3 TRCN0000127178 CGAGAGTAGAAATGCTGCCAA pLKO.1 2979 CDS 100% 2.640 1.848 N Nol4 n/a
4 TRCN0000127177 CTCAATAGAAAGTGACGAATT pLKO.1 2322 CDS 100% 0.000 0.000 N Nol4 n/a
5 TRCN0000424309 ACCAAGACGGTGACCCGTAAA pLKO_005 1706 5UTR 100% 10.800 15.120 N NOL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11297 pDONR223 100% 72.8% 76.3% None (many diffs) n/a
2 ccsbBroad304_11297 pLX_304 0% 72.8% 76.3% V5 (many diffs) n/a
3 TRCN0000474534 TAATTCATAGTAGGTCAAAAGAAC pLX_317 41.4% 72.8% 76.3% V5 (many diffs) n/a
Download CSV