Transcript: Mouse XM_017317990.1

PREDICTED: Mus musculus Rho GTPase activating protein 26 (Arhgap26), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap26 (71302)
Length:
5328
CDS:
16..2166

Additional Resources:

NCBI RefSeq record:
XM_017317990.1
NBCI Gene record:
Arhgap26 (71302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094891 CGGAGTCGAATGATCGAGAAT pLKO.1 424 CDS 100% 4.950 6.930 N Arhgap26 n/a
2 TRCN0000094890 CGGCAACATTTCTACGAAGTA pLKO.1 634 CDS 100% 4.950 6.930 N Arhgap26 n/a
3 TRCN0000424983 GCGAGATCTTTGCAAGAATTT pLKO_005 373 CDS 100% 13.200 9.240 N Arhgap26 n/a
4 TRCN0000094893 CCAGTTTCAAAGAAGTTTCAT pLKO.1 1524 CDS 100% 5.625 3.938 N Arhgap26 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5269 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317990.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07836 pDONR223 100% 74.1% 75.7% None (many diffs) n/a
2 ccsbBroad304_07836 pLX_304 0% 74.1% 75.7% V5 (many diffs) n/a
3 TRCN0000469771 TCTGGCCGAGTACCGTGCCCTATT pLX_317 18.1% 74.1% 75.7% V5 (many diffs) n/a
Download CSV