Transcript: Mouse XM_017318010.1

PREDICTED: Mus musculus membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7) (Mpp7), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mpp7 (75739)
Length:
1159
CDS:
269..1159

Additional Resources:

NCBI RefSeq record:
XM_017318010.1
NBCI Gene record:
Mpp7 (75739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239240 GACAAGGCAATCCCGTGTAAA pLKO_005 998 CDS 100% 13.200 18.480 N Mpp7 n/a
2 TRCN0000239242 TCGAAAGAAGGCAAGATATTT pLKO_005 944 CDS 100% 15.000 12.000 N Mpp7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09602 pDONR223 100% 44.7% 46.7% None (many diffs) n/a
2 ccsbBroad304_09602 pLX_304 0% 44.7% 46.7% V5 (many diffs) n/a
3 ccsbBroadEn_15255 pDONR223 87.3% 44.7% 74.6% None (many diffs) n/a
4 ccsbBroad304_15255 pLX_304 0% 44.7% 74.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000469992 TACTATCCTTGAGGTCGAGTTTCT pLX_317 23.6% 44.7% 74.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV