Construct: ORF TRCN0000469992
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018847.3_s317c1
- Derived from:
- ccsbBroadEn_15255
- DNA Barcode:
- TACTATCCTTGAGGTCGAGTTTCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MPP7 (143098)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469992
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 143098 | MPP7 | membrane palmitoylated prot... | NM_001318170.2 | 99.7% | 42.5% | (many diffs) |
| 2 | human | 143098 | MPP7 | membrane palmitoylated prot... | NM_173496.5 | 99.7% | 42.5% | (many diffs) |
| 3 | human | 143098 | MPP7 | membrane palmitoylated prot... | XM_011519337.2 | 99.7% | 42.5% | (many diffs) |
| 4 | human | 143098 | MPP7 | membrane palmitoylated prot... | XM_017015742.1 | 99.4% | 42.1% | (many diffs) |
| 5 | human | 143098 | MPP7 | membrane palmitoylated prot... | XM_017015741.1 | 83.2% | 30.2% | (many diffs) |
| 6 | human | 143098 | MPP7 | membrane palmitoylated prot... | XM_011519338.2 | 78% | 20.8% | (many diffs) |
| 7 | human | 143098 | MPP7 | membrane palmitoylated prot... | XM_005252369.3 | 55.1% | 77% | 732_733insA;954_954delCins775 |
| 8 | human | 143098 | MPP7 | membrane palmitoylated prot... | XM_017015743.2 | 44.6% | 48.9% | (many diffs) |
| 9 | human | 143098 | MPP7 | membrane palmitoylated prot... | NR_134517.2 | 32.7% | (many diffs) | |
| 10 | human | 143098 | MPP7 | membrane palmitoylated prot... | NR_134518.2 | 31.7% | (many diffs) | |
| 11 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | NM_001081287.2 | 87.7% | 38.3% | (many diffs) |
| 12 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_006526326.3 | 87.7% | 38.3% | (many diffs) |
| 13 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_017318007.1 | 87.7% | 38.3% | (many diffs) |
| 14 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_006526325.3 | 84.2% | 36.8% | (many diffs) |
| 15 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_011247025.2 | 84.1% | 36.7% | (many diffs) |
| 16 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_011247026.2 | 84.1% | 36.7% | (many diffs) |
| 17 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_011247027.2 | 84.1% | 36.7% | (many diffs) |
| 18 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_017318006.1 | 84.1% | 36.7% | (many diffs) |
| 19 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_006526327.2 | 80.4% | 38.5% | (many diffs) |
| 20 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | NM_001161620.1 | 61.9% | 51.7% | (many diffs) |
| 21 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_006526330.3 | 52% | 61.2% | (many diffs) |
| 22 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_017318009.1 | 47.9% | 69.7% | (many diffs) |
| 23 | mouse | 75739 | Mpp7 | membrane protein, palmitoyl... | XM_017318010.1 | 44.7% | 74.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 816
- ORF length:
- 747
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccagctttg tcaacgggat ctgggagtga cactggtctg tatgagctgt 121 tggctgctct gccagcccag ctgcagccac atgtggatag ccaggaagac ctgaccttcc 181 tctgggatat gtttggtgaa aaaagcctgc attcattggt aaagattcat gaaaaactac 241 actactatga gaagcagagt ccggtgccca ttctccatgg tgcggcggcc ttggccgatg 301 atctggccga agagcttcag aacaagccat taaacagtga gatcagagag ctgttgaaac 361 tactgtcaaa acccaatgtg aaggctttgc tctctgtaca tgatactgtg gctcagaaga 421 attacgaccc agtgttgcct cctatgcctg aagatattga cgatgaggaa gactcagtaa 481 aaataatccg tctggtcaaa aatagagaac cactgggagc taccattaag aaggatgaac 541 agaccggggc gatcattgtg gccagaatca tgagaggagg agctgcagat agaagtggtc 601 ttattcatgt tggtgatgaa cttagggaag tcaacgggat accagtggag gataaaaggc 661 ctgaggaaat aatacagatt ttggctcagt ctcagggagc aattacattt aagattatac 721 ccggcagcaa agaggagaca ccatcaaaag aaggcaagat gtttatcaaa gccctctttg 781 actataatcc taatgaggat aaaggcaatt ccatgtaagg aagctgggct ttctttcaaa 841 aagggagata ttcttcagat tatgagccaa gatgatgcaa cttggtggca agcgaaacac 901 gaagctgatg ccaaccccag ggcaggcttg atcccctcaa agcatttcca ggaaaggaga 961 ttggctttga gacgaccaga aatattggtt cagcccctga aagtttccaa caggaaatca 1021 tctggtttta gaagaagatg tcgtcttagt agaaaagata agaaaacaaa taaatccatg 1081 tatgaatgca agaagagtga tcagtacgac acagctgacg tacccacata cgaagaagtg 1141 acaccgtatc ggcgacaaac taatgaaaaa tacagactcg ttgtcttggt tggtcccgtg 1201 ggagtagggc tgaatgaact gaaacgaaag ctgctgatca gtgacaccca gcactatggc 1261 gtgacagtgc cccataccac cagagcaaga agaagccagg agagtgatgg tgttgaatac 1321 attttcattt ccaagcattt gtttgagaca gatgtacaaa ataacaagtt tattgaatat 1381 ggagaatata aaaaCAACTA CTACGGCACA AGTATAGACT CAGTTCGGTC TGTCCTTGCT 1441 AAAAACAAAG TTTGTTTGTT GGATGTTCAG CCTCATACAG TGAAGCATTT AAGGACACTA 1501 GAATTTAAGC CCTATGTGAT ATTTATAAAG CCTCCATCAA TAGAGCGTTT GAGAGAAACA 1561 AGAAAAAATG CAAAGATTAT TTCAAGCAGA GATGACCAAG GTGCTGCAAA ACCCTTCACA 1621 GAAGAAGATT TTCAAGAAAT GATTAAATCT GCACAGATAA TGGAAAGTCA ATATGGTCAT 1681 CTTTTTGACA AAATTATAAT AAATGATGAC CTCACTGTGG CATTCAATGA GCTCAAAACA 1741 ACTTTTGACA AATTAGAGAC AGAGACCCAT TGGGTGCCAG TGAGCTGGTT ACATTCATTG 1801 CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT 1861 CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT 1921 TATATATCTT GTGGAAAGGA CGATACTATC CTTGAGGTCG AGTTTCTACG CGTTAAGTCg 1981 acaatcaacc tctggattac aaaatttgtg aaagatt