Transcript: Mouse XM_017318206.1

PREDICTED: Mus musculus fermitin family member 1 (Fermt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fermt1 (241639)
Length:
4947
CDS:
423..2456

Additional Resources:

NCBI RefSeq record:
XM_017318206.1
NBCI Gene record:
Fermt1 (241639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083944 CCTACTACCTTGTCAGATTTA pLKO.1 2125 CDS 100% 13.200 9.240 N FERMT1 n/a
2 TRCN0000193239 CTAAGTGCAGATTGCAAGATT pLKO.1 2328 CDS 100% 5.625 3.938 N Fermt1 n/a
3 TRCN0000176070 GTGGAGATTCGCCAATATGAA pLKO.1 2231 CDS 100% 5.625 3.938 N Fermt1 n/a
4 TRCN0000175332 CACCTACTACCTTGTCAGATT pLKO.1 2123 CDS 100% 4.950 3.465 N Fermt1 n/a
5 TRCN0000173772 CAGAGGTCATCAGCATCCTTT pLKO.1 1873 CDS 100% 4.950 3.465 N Fermt1 n/a
6 TRCN0000175547 CAGCATCCTTTCGTTTCTCAA pLKO.1 1883 CDS 100% 4.950 3.465 N Fermt1 n/a
7 TRCN0000193238 CCTTTCGTTTCTCAAGATGAA pLKO.1 1889 CDS 100% 4.950 3.465 N Fermt1 n/a
8 TRCN0000173934 GATGAGGACCTCTTCCACAAA pLKO.1 2415 CDS 100% 4.950 3.465 N Fermt1 n/a
9 TRCN0000173840 CCATGAGTACATTGGTGGCTA pLKO.1 2351 CDS 100% 2.640 1.848 N Fermt1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3421 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12233 pDONR223 100% 53.6% 55% None (many diffs) n/a
2 ccsbBroad304_12233 pLX_304 0% 53.6% 55% V5 (many diffs) n/a
3 TRCN0000476913 CAATAACAACTACGCATTTTGACC pLX_317 25.7% 53.6% 55% V5 (many diffs) n/a
Download CSV