Transcript: Mouse XM_017318223.1

PREDICTED: Mus musculus polycystic kidney disease 2-like 1 (Pkd2l1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkd2l1 (329064)
Length:
4206
CDS:
1141..3336

Additional Resources:

NCBI RefSeq record:
XM_017318223.1
NBCI Gene record:
Pkd2l1 (329064)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097742 CCTACGGAATGACAAGTTCTA pLKO.1 1406 CDS 100% 4.950 6.930 N Pkd2l1 n/a
2 TRCN0000428650 ATTGATGCTGTAGGCTCAAAG pLKO_005 3226 CDS 100% 10.800 7.560 N PKD2L1 n/a
3 TRCN0000418768 CCCACTCCTTCATCTACTATG pLKO_005 1604 CDS 100% 10.800 7.560 N PKD2L1 n/a
4 TRCN0000097741 CCAGACACGTATGCAGACTTT pLKO.1 2317 CDS 100% 4.950 3.465 N Pkd2l1 n/a
5 TRCN0000097744 GTACTGGACAAAGTGGTACAA pLKO.1 1560 CDS 100% 4.950 3.465 N Pkd2l1 n/a
6 TRCN0000097743 CCCTGTGTACTTTGTCACCTA pLKO.1 2664 CDS 100% 2.640 1.848 N Pkd2l1 n/a
7 TRCN0000097740 GCCAGAGTTGATTGACATCAA pLKO.1 3654 3UTR 100% 0.495 0.347 N Pkd2l1 n/a
8 TRCN0000434497 CTACAACAAGACCCTACTAAG pLKO_005 2814 CDS 100% 10.800 6.480 N PKD2L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07343 pDONR223 100% 78.9% 79% None (many diffs) n/a
2 ccsbBroad304_07343 pLX_304 0% 78.9% 79% V5 (many diffs) n/a
3 TRCN0000479162 GCTTTTTACAGAAGAATATCGCAT pLX_317 17% 78.9% 79% V5 (many diffs) n/a
Download CSV