Transcript: Mouse XM_017318268.1

PREDICTED: Mus musculus RNA terminal phosphate cyclase-like 1 (Rcl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rcl1 (59028)
Length:
1309
CDS:
112..750

Additional Resources:

NCBI RefSeq record:
XM_017318268.1
NBCI Gene record:
Rcl1 (59028)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102448 GCTAATGACCTGCGTTGGTAT pLKO.1 696 CDS 100% 4.950 6.930 N Rcl1 n/a
2 TRCN0000317215 GCTAATGACCTGCGTTGGTAT pLKO_005 696 CDS 100% 4.950 6.930 N Rcl1 n/a
3 TRCN0000102445 CCTCTTAACATTACAGACTTT pLKO.1 848 3UTR 100% 4.950 3.465 N Rcl1 n/a
4 TRCN0000313690 TGTGGCTCTGTGTAGGGTTTA pLKO_005 1054 3UTR 100% 10.800 6.480 N Rcl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02339 pDONR223 100% 48.1% 43.6% None (many diffs) n/a
2 ccsbBroad304_02339 pLX_304 0% 48.1% 43.6% V5 (many diffs) n/a
3 TRCN0000467913 ATATATCGTAAGAGCATTCGAGTT pLX_317 32.7% 48.1% 43.6% V5 (many diffs) n/a
Download CSV