Transcript: Mouse XM_017318374.1

PREDICTED: Mus musculus dystrophin, muscular dystrophy (Dmd), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmd (13405)
Length:
16173
CDS:
2608..13605

Additional Resources:

NCBI RefSeq record:
XM_017318374.1
NBCI Gene record:
Dmd (13405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077146 CGGAAGTAAATCTGGATAGTT pLKO.1 3623 CDS 100% 5.625 7.875 N Dmd n/a
2 TRCN0000077147 GCGGCAAATTGAGAGCAATTT pLKO.1 8481 CDS 100% 1.320 1.848 N Dmd n/a
3 TRCN0000077145 CCGACCTGTTTGATTGGAATA pLKO.1 3140 CDS 100% 10.800 8.640 N Dmd n/a
4 TRCN0000077143 CCACCAAATGACTGCTTCATA pLKO.1 14234 3UTR 100% 5.625 3.938 N Dmd n/a
5 TRCN0000053245 CCAGCATTACTGCCAAAGTTT pLKO.1 12963 CDS 100% 5.625 3.938 N DMD n/a
6 TRCN0000053243 CCCTAGTTCAAGAGGAAGAAA pLKO.1 13548 CDS 100% 5.625 3.938 N DMD n/a
7 TRCN0000077144 GCCAATAATAAACCTGAGATT pLKO.1 12394 CDS 100% 4.950 3.465 N Dmd n/a
8 TRCN0000053246 CCAGTCTTTAGCTGACCTGAA pLKO.1 11862 CDS 100% 4.050 2.835 N DMD n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 14064 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318374.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06103 pDONR223 100% 15.2% 15.8% None (many diffs) n/a
2 ccsbBroad304_06103 pLX_304 0% 15.2% 15.8% V5 (many diffs) n/a
3 TRCN0000481202 TACATTCTGGCATTCTTTAAGCAA pLX_317 24.3% 15.2% 15.8% V5 (many diffs) n/a
Download CSV