Transcript: Mouse XM_017318524.2

PREDICTED: Mus musculus OCRL, inositol polyphosphate-5-phosphatase (Ocrl), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Ocrl (320634)
Length:
5758
CDS:
236..2914

Additional Resources:

NCBI RefSeq record:
XM_017318524.2
NBCI Gene record:
Ocrl (320634)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080955 CGTCCGCATTATGGACAGAAT pLKO.1 1882 CDS 100% 4.950 6.930 N Ocrl n/a
2 TRCN0000080957 GCATTCCTTCGTGAACTCTTA pLKO.1 2729 CDS 100% 4.950 6.930 N Ocrl n/a
3 TRCN0000304000 CAAGCCAAAGTTACCATATTT pLKO_005 3106 3UTR 100% 15.000 10.500 N OCRL n/a
4 TRCN0000080956 GCTTGGATTTGAGGATAATTT pLKO.1 676 CDS 100% 15.000 10.500 N Ocrl n/a
5 TRCN0000048205 GCTTCTTATATTTGCCAGAAA pLKO.1 1201 CDS 100% 4.950 3.465 N OCRL n/a
6 TRCN0000080954 CCTGAGACAATTCCTGGCAAT pLKO.1 2537 CDS 100% 4.050 2.835 N Ocrl n/a
7 TRCN0000080953 GCCCTTAAATAATTGGGAGTT pLKO.1 4436 3UTR 100% 4.050 2.835 N Ocrl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06668 pDONR223 100% 88.5% 91.3% None (many diffs) n/a
2 ccsbBroad304_06668 pLX_304 0% 88.5% 91.3% V5 (many diffs) n/a
3 TRCN0000476592 TAGTGTACTGACCAGTTAATTGTC pLX_317 14.2% 88.5% 91.3% V5 (many diffs) n/a
Download CSV