Transcript: Mouse XM_017318899.1

PREDICTED: Mus musculus SEC23 homolog B, COPII coat complex component (Sec23b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec23b (27054)
Length:
2840
CDS:
167..2470

Additional Resources:

NCBI RefSeq record:
XM_017318899.1
NBCI Gene record:
Sec23b (27054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364242 CCGAGGGACCAAGGATTTAAC pLKO_005 733 CDS 100% 13.200 18.480 N Sec23b n/a
2 TRCN0000100482 GCAGGCATATCTGAGGTGAAT pLKO.1 461 CDS 100% 4.950 6.930 N Sec23b n/a
3 TRCN0000378407 TTCGTTCCTGGCACGACATTG pLKO_005 1101 CDS 100% 10.800 8.640 N Sec23b n/a
4 TRCN0000100483 CGGAGATTTCAGAATGGCGTT pLKO.1 1357 CDS 100% 2.160 1.728 N Sec23b n/a
5 TRCN0000364243 CTTCCCAATGCCACGTTATAT pLKO_005 2269 CDS 100% 15.000 10.500 N Sec23b n/a
6 TRCN0000368834 GTATGTCTTCAGGCTATAATA pLKO_005 2596 3UTR 100% 15.000 10.500 N Sec23b n/a
7 TRCN0000100480 CCTGCTAATTGTAGATGTTTA pLKO.1 2691 3UTR 100% 13.200 9.240 N Sec23b n/a
8 TRCN0000364244 TAAAGACTTCAACGGAGATTT pLKO_005 1345 CDS 100% 13.200 9.240 N Sec23b n/a
9 TRCN0000100484 TCCCTCATCTACTCTTGGCAT pLKO.1 1528 CDS 100% 2.640 1.848 N Sec23b n/a
10 TRCN0000368871 CTGATGAGTCCTCCTATTATA pLKO_005 1962 CDS 100% 15.000 9.000 N Sec23b n/a
11 TRCN0000364241 TCAGAAGTTTGGGCAGTATAA pLKO_005 1834 CDS 100% 13.200 7.920 N Sec23b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02453 pDONR223 100% 90.6% 97.1% None (many diffs) n/a
2 ccsbBroad304_02453 pLX_304 0% 90.6% 97.1% V5 (many diffs) n/a
3 TRCN0000478533 ACAGTTATCCATCCCACTTCTTAC pLX_317 12.7% 90.6% 97.1% V5 (many diffs) n/a
4 ccsbBroadEn_07619 pDONR223 100% 90.5% 96.8% None (many diffs) n/a
5 ccsbBroad304_07619 pLX_304 0% 90.5% 96.8% V5 (many diffs) n/a
Download CSV