Transcript: Mouse XM_017319122.1

PREDICTED: Mus musculus autophagy related 13 (Atg13), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg13 (51897)
Length:
3604
CDS:
366..1838

Additional Resources:

NCBI RefSeq record:
XM_017319122.1
NBCI Gene record:
Atg13 (51897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174350 CGACTTTGTTATGATTGACTT pLKO.1 1610 CDS 100% 4.950 6.930 N Atg13 n/a
2 TRCN0000277120 CGACTTTGTTATGATTGACTT pLKO_005 1610 CDS 100% 4.950 6.930 N Atg13 n/a
3 TRCN0000277121 TGAAGTCTCTTCTCGCTATTA pLKO_005 739 CDS 100% 13.200 9.240 N Atg13 n/a
4 TRCN0000193889 CTGAAGTCTCTTCTCGCTATT pLKO.1 738 CDS 100% 10.800 7.560 N Atg13 n/a
5 TRCN0000216767 GCGATCTATGTGTGTGGAAAT pLKO.1 596 CDS 100% 10.800 7.560 N Atg13 n/a
6 TRCN0000194487 GCGGAAGATTTGGACTCCTTA pLKO.1 1749 CDS 100% 4.950 3.465 N Atg13 n/a
7 TRCN0000174899 GCTTATAGAATTAACTTGGCA pLKO.1 927 CDS 100% 0.750 0.525 N Atg13 n/a
8 TRCN0000285859 GTCCTCAGCTGCTTCACAAAG pLKO_005 2090 3UTR 100% 10.800 6.480 N Atg13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14028 pDONR223 100% 77.9% 82.2% None (many diffs) n/a
2 ccsbBroad304_14028 pLX_304 0% 77.9% 82.2% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000474634 TCTAACACTGCAATAGATTCCCGC pLX_317 36.4% 77.9% 82.2% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_15678 pDONR223 0% 69.7% 65% None (many diffs) n/a
5 ccsbBroad304_15678 pLX_304 0% 69.7% 65% V5 (many diffs) n/a
6 TRCN0000471230 TTAAGTCGTCACACAAGTTTCACA pLX_317 35.8% 69.7% 65% V5 (many diffs) n/a
Download CSV