Transcript: Mouse XM_017319186.1

PREDICTED: Mus musculus methionyl aminopeptidase type 1D (mitochondrial) (Metap1d), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Metap1d (66559)
Length:
1523
CDS:
79..1290

Additional Resources:

NCBI RefSeq record:
XM_017319186.1
NBCI Gene record:
Metap1d (66559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052160 CCACTCAATCATATCTACTTA pLKO.1 142 CDS 100% 5.625 7.875 N METAP1D n/a
2 TRCN0000031827 GCCACTCAATCATATCTACTT pLKO.1 141 CDS 100% 4.950 6.930 N Metap1d n/a
3 TRCN0000031825 GCGCATAAAGAAGCCAGACTA pLKO.1 276 CDS 100% 4.950 3.960 N Metap1d n/a
4 TRCN0000430391 ATGGAGATATTATCAACATTG pLKO_005 590 CDS 100% 10.800 7.560 N METAP1D n/a
5 TRCN0000052161 CTCTGTAATTGGAAACACAAT pLKO.1 759 CDS 100% 4.950 3.465 N METAP1D n/a
6 TRCN0000031824 GCAGTCAACAAAGAAGACATT pLKO.1 176 CDS 100% 4.950 3.465 N Metap1d n/a
7 TRCN0000031826 GAAACCTTTCTGGTGGGCAAT pLKO.1 652 CDS 100% 4.050 2.835 N Metap1d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319186.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05297 pDONR223 100% 75.1% 69.2% None (many diffs) n/a
2 ccsbBroad304_05297 pLX_304 0% 75.1% 69.2% V5 (many diffs) n/a
3 TRCN0000476162 GGTTCCATCTAAAGTGATAGATCC pLX_317 31.7% 75.1% 69.2% V5 (many diffs) n/a
Download CSV