Transcript: Mouse XM_017319213.1

PREDICTED: Mus musculus myosin IB (Myo1b), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myo1b (17912)
Length:
4766
CDS:
507..3467

Additional Resources:

NCBI RefSeq record:
XM_017319213.1
NBCI Gene record:
Myo1b (17912)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100867 GCGTTCAGTTTCCGAACAGTT pLKO.1 1110 CDS 100% 4.950 6.930 N Myo1b n/a
2 TRCN0000302795 GCGTTCAGTTTCCGAACAGTT pLKO_005 1110 CDS 100% 4.950 6.930 N Myo1b n/a
3 TRCN0000100869 CCTGATTGAAATGGCAACCAA pLKO.1 3263 CDS 100% 3.000 4.200 N Myo1b n/a
4 TRCN0000302794 CCTGATTGAAATGGCAACCAA pLKO_005 3263 CDS 100% 3.000 4.200 N Myo1b n/a
5 TRCN0000100866 CCACTCTCATTCAGAAGATTT pLKO.1 2266 CDS 100% 13.200 9.240 N Myo1b n/a
6 TRCN0000302792 CCACTCTCATTCAGAAGATTT pLKO_005 2266 CDS 100% 13.200 9.240 N Myo1b n/a
7 TRCN0000413182 CTATCATTTGTGACCTAATAG pLKO_005 1471 CDS 100% 13.200 9.240 N MYO1B n/a
8 TRCN0000100865 GCTAACTGTTAGCGTCCTCTT pLKO.1 3568 3UTR 100% 4.050 2.835 N Myo1b n/a
9 TRCN0000302721 GCTAACTGTTAGCGTCCTCTT pLKO_005 3568 3UTR 100% 4.050 2.835 N Myo1b n/a
10 TRCN0000100868 GCCGGAGAAAGTGGAAGATTA pLKO.1 338 5UTR 100% 13.200 7.920 N Myo1b n/a
11 TRCN0000302793 GCCGGAGAAAGTGGAAGATTA pLKO_005 338 5UTR 100% 13.200 7.920 N Myo1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.