Transcript: Mouse XM_017319464.1

PREDICTED: Mus musculus signal transducer and activator of transcription 1 (Stat1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stat1 (20846)
Length:
4174
CDS:
300..2549

Additional Resources:

NCBI RefSeq record:
XM_017319464.1
NBCI Gene record:
Stat1 (20846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235835 CCTATGAGCCCGACCCTATTA pLKO_005 1162 CDS 100% 13.200 18.480 N Stat1 n/a
2 TRCN0000235837 GGACTAGAGTGCGAGTATTTG pLKO_005 2813 3UTR 100% 13.200 18.480 N Stat1 n/a
3 TRCN0000235838 ACGCCTTTGGGAAGTATTATT pLKO_005 2323 CDS 100% 15.000 10.500 N Stat1 n/a
4 TRCN0000235836 CTGTTACTTTCCCAGATATTA pLKO_005 2221 CDS 100% 15.000 10.500 N Stat1 n/a
5 TRCN0000054926 GCTGTTACTTTCCCAGATATT pLKO.1 2220 CDS 100% 13.200 9.240 N Stat1 n/a
6 TRCN0000235839 TTGCAAGAGCTGAACTATAAC pLKO_005 1350 CDS 100% 13.200 9.240 N Stat1 n/a
7 TRCN0000054924 CCGAAGAACTTCACTCTCTTA pLKO.1 1579 CDS 100% 4.950 3.465 N Stat1 n/a
8 TRCN0000054923 GCCGAGAACATACCAGAGAAT pLKO.1 2265 CDS 100% 4.950 3.465 N Stat1 n/a
9 TRCN0000054925 GCTGCCTATGATGTCTCGTTT pLKO.1 435 CDS 100% 4.950 3.465 N Stat1 n/a
10 TRCN0000054927 GCTCACTCAGAACACTCTGAT pLKO.1 974 CDS 100% 0.495 0.347 N Stat1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319464.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01607 pDONR223 100% 82.2% 89% None (many diffs) n/a
2 ccsbBroad304_01607 pLX_304 28.1% 82.2% 89% V5 (many diffs) n/a
3 TRCN0000472828 GCACTTCAACGCACACGCCCATTC pLX_317 14.2% 82.2% 89% V5 (many diffs) n/a
Download CSV