Transcript: Mouse XM_017319470.1

PREDICTED: Mus musculus LIM homeobox protein 8 (Lhx8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lhx8 (16875)
Length:
1886
CDS:
205..1215

Additional Resources:

NCBI RefSeq record:
XM_017319470.1
NBCI Gene record:
Lhx8 (16875)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070573 CTCGATTACTTCAGACGGTAT pLKO.1 550 CDS 100% 4.050 5.670 N Lhx8 n/a
2 TRCN0000070577 GCCTGGAGATTGTGGACAAAT pLKO.1 410 CDS 100% 13.200 9.240 N Lhx8 n/a
3 TRCN0000414864 TGTTGGAAGAAATGGCTTATT pLKO_005 1091 CDS 100% 13.200 9.240 N Lhx8 n/a
4 TRCN0000422158 GAGAAGTGGAGAACGGTAATG pLKO_005 770 CDS 100% 10.800 7.560 N Lhx8 n/a
5 TRCN0000070576 GAGCTGCTACATTAAGGATAA pLKO.1 513 CDS 100% 10.800 7.560 N Lhx8 n/a
6 TRCN0000412257 TTGACTGCATGCTGGACAATC pLKO_005 743 CDS 100% 10.800 7.560 N Lhx8 n/a
7 TRCN0000070574 CCAGGTTATGCAAGCACAGTT pLKO.1 885 CDS 100% 4.950 3.465 N Lhx8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10157 pDONR223 100% 83.4% 88.7% None (many diffs) n/a
2 ccsbBroad304_10157 pLX_304 62.9% 83.4% 88.7% V5 (many diffs) n/a
3 TRCN0000465899 GAGAGTTCGCTCAGAAAAATCGGC pLX_317 30.8% 83.4% 88.7% V5 (many diffs) n/a
Download CSV