Transcript: Mouse XM_017319490.1

PREDICTED: Mus musculus phospholipase D1 (Pld1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pld1 (18805)
Length:
5340
CDS:
615..3839

Additional Resources:

NCBI RefSeq record:
XM_017319490.1
NBCI Gene record:
Pld1 (18805)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348897 GCTCGAAACGCTACCATATAT pLKO_005 3588 CDS 100% 15.000 21.000 N Pld1 n/a
2 TRCN0000375650 CAGTGGTCACCCTGATATAAG pLKO_005 3977 3UTR 100% 13.200 18.480 N Pld1 n/a
3 TRCN0000379272 TATGGACTTCGGATCGATAAT pLKO_005 1497 CDS 100% 13.200 18.480 N Pld1 n/a
4 TRCN0000076819 CCCATCTCAAAGATTGTTGAT pLKO.1 2220 CDS 100% 4.950 6.930 N Pld1 n/a
5 TRCN0000076822 GCTCTCCATGAGAACACGTTA pLKO.1 1647 CDS 100% 4.950 3.960 N Pld1 n/a
6 TRCN0000076818 GCTGCCTACATCCATGTAATA pLKO.1 2904 CDS 100% 13.200 9.240 N Pld1 n/a
7 TRCN0000076821 GCTTGGTAATAAGTGGATAAA pLKO.1 3206 CDS 100% 13.200 9.240 N Pld1 n/a
8 TRCN0000352178 GCTTGGTAATAAGTGGATAAA pLKO_005 3206 CDS 100% 13.200 9.240 N Pld1 n/a
9 TRCN0000001009 GCAAGTTAAGAGGAAATTCAA pLKO.1 956 CDS 100% 5.625 3.938 N PLD1 n/a
10 TRCN0000076820 CCCAATGATGAAGTACACAAT pLKO.1 3630 CDS 100% 4.950 3.465 N Pld1 n/a
11 TRCN0000352251 CCCAATGATGAAGTACACAAT pLKO_005 3630 CDS 100% 4.950 3.465 N Pld1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01216 pDONR223 100% 84.9% 91.1% None (many diffs) n/a
2 ccsbBroad304_01216 pLX_304 0% 84.9% 91.1% V5 (many diffs) n/a
3 TRCN0000470850 GCCGCTAACCCCAAAACTTCAATT pLX_317 12.6% 84.9% 91.1% V5 (many diffs) n/a
Download CSV