Transcript: Mouse XM_017319544.2

PREDICTED: Mus musculus golgi phosphoprotein 3-like (Golph3l), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Golph3l (229593)
Length:
2745
CDS:
53..580

Additional Resources:

NCBI RefSeq record:
XM_017319544.2
NBCI Gene record:
Golph3l (229593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111668 CGAACCAAGGACCTAGTAGAA pLKO.1 868 3UTR 100% 4.950 6.930 N Golph3l n/a
2 TRCN0000348340 CAGTGGGAACAAGACTAATTT pLKO_005 1426 3UTR 100% 15.000 10.500 N Golph3l n/a
3 TRCN0000375410 GACAGAGAAACAGCGACTAAT pLKO_005 690 3UTR 100% 13.200 9.240 N Golph3l n/a
4 TRCN0000375409 GATAAGATGCTATCATCATTT pLKO_005 1042 3UTR 100% 13.200 9.240 N Golph3l n/a
5 TRCN0000111667 CCACTCATCCAGTGACCAATA pLKO.1 668 3UTR 100% 10.800 7.560 N Golph3l n/a
6 TRCN0000334496 CCACTCATCCAGTGACCAATA pLKO_005 668 3UTR 100% 10.800 7.560 N Golph3l n/a
7 TRCN0000111666 CCCTGGAGACTCTAAGGATAT pLKO.1 337 CDS 100% 10.800 7.560 N Golph3l n/a
8 TRCN0000111669 GAGACATGGAACCCTTTCAAA pLKO.1 544 CDS 100% 5.625 3.938 N Golph3l n/a
9 TRCN0000334575 GAGACATGGAACCCTTTCAAA pLKO_005 544 CDS 100% 5.625 3.938 N Golph3l n/a
10 TRCN0000111665 CCCTCTAAATTGTGTCTTCTT pLKO.1 2043 3UTR 100% 4.950 3.465 N Golph3l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319544.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08491 pDONR223 100% 30.6% 28.6% None (many diffs) n/a
2 ccsbBroad304_08491 pLX_304 0% 30.6% 28.6% V5 (many diffs) n/a
3 TRCN0000469838 TATTCTACATGCCATGTGTGGCCG pLX_317 22.8% 30.6% 28.6% V5 (many diffs) n/a
Download CSV