Transcript: Mouse XM_017319971.1

PREDICTED: Mus musculus exoribonuclease 3 (Eri3), transcript variant X25, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Eri3 (140546)
Length:
843
CDS:
121..714

Additional Resources:

NCBI RefSeq record:
XM_017319971.1
NBCI Gene record:
Eri3 (140546)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177778 CCAAACGTCAAGTCAATCTTT pLKO.1 295 CDS 100% 5.625 7.875 N Eri3 n/a
2 TRCN0000293053 CCAAACGTCAAGTCAATCTTT pLKO_005 295 CDS 100% 5.625 7.875 N Eri3 n/a
3 TRCN0000181397 CATGGAAATCGAGTCTACCTT pLKO.1 120 5UTR 100% 3.000 4.200 N Eri3 n/a
4 TRCN0000298107 CATGGAAATCGAGTCTACCTT pLKO_005 120 5UTR 100% 3.000 4.200 N Eri3 n/a
5 TRCN0000135044 CAAGAACATTGCCAACATCAT pLKO.1 763 3UTR 100% 4.950 3.465 N ERI3 n/a
6 TRCN0000178220 GATTACTTCAAGCAGTGGATT pLKO.1 388 CDS 100% 4.950 3.465 N Eri3 n/a
7 TRCN0000293052 GATTACTTCAAGCAGTGGATT pLKO_005 388 CDS 100% 4.950 3.465 N Eri3 n/a
8 TRCN0000135397 GCTTCATCTTCAAGCAGACAT pLKO.1 804 3UTR 100% 4.950 3.465 N ERI3 n/a
9 TRCN0000134696 GATCCAAACGTCAAGTCAATT pLKO.1 292 CDS 100% 13.200 18.480 N ERI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319971.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12532 pDONR223 100% 57.9% 51.9% None (many diffs) n/a
2 ccsbBroad304_12532 pLX_304 0% 57.9% 51.9% V5 (many diffs) n/a
3 TRCN0000466801 TGCCTATACCACAGTATAAGGTTT pLX_317 64.1% 57.9% 51.9% V5 (many diffs) n/a
Download CSV